# Basic Sequence Analyses

* The Seq object deals with sequences. There are different methods between Seq objects and standard Python strings.

```
In [1]: import Bio

In [2]: Bio.__version__
Out[2]: '1.84'

In [3]: from Bio.Seq import Seq

In [4]: my_seq=Seq("TCATGTGTCCATACTTGATCATAG")

In [5]: my_seq.reverse_complement()
Out[5]: Seq('CTATGATCAAGTATGGACACATGA')

In [6]: my_seq.transcribe()
Out[6]: Seq('UCAUGUGUCCAUACUUGAUCAUAG')

In [7]: my_seq.translate()
Out[7]: Seq('SCVHT*S*')

In [8]: my_seq.translate(to_stop=True)
Out[8]: Seq('SCVHT')
```

* GC functions in Bio.SeqUtils module to calculate a GC%,

```
In [1]: import Bio

In [2]: from Bio.Seq import Seq

In [3]: from Bio.SeqUtils import gc_fraction

In [4]: my_seq=Seq("ACTG")

In [5]: gc_fraction(my_seq)
Out[5]: 50.0
```


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://igb.mit.edu/mini-courses/python/biopython/quick-start/basic-sequence-analyses.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.